b1463

Information for b1463, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1531306-1531923 - CDS b1462 EG13779 orf; hypothetical protein 1532048-1532893 + CDS b1463 EG13780 putative N-hydroxyarylamine O-acetyltransferase 1532989-1533882 - CDS yddE EG11825 orf; hypothetical protein

Reported regulatory sites for b1463: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.931 1531986-1532007 cacaa AATAGCCGGTGCGGCGTCTATT ccagg - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back