b1481

Information for b1481, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1553850-1553987 - CDS rpsV EG11508 30S ribosomal subunit protein S22 1554089-1554367 - CDS b1481 EG14301 orf; hypothetical protein 1554649-1555080 + CDS osmC EG10680 osmotically inducible protein

Reported regulatory sites for b1481: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.774 1554534-1554556 R gcgaa AATATTACTTCTGCACTTAAATT aaatt - 0 - 1.672 1554461-1554484 R ttgta TCAATATTAATCGGATCATACCAA tcaca - 0 - 1.672 1554425-1554448 R cccta TGAATATCATGGTGTTAAAATATA aaaat - 0 - 1.539 1554398-1554413 R atcaa CCAGGACTAATCTTAA caacg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back