b1491

Information for b1491, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1563782-1565164 - CDS b1490 EG13793 orf; hypothetical protein 1565528-1566847 - CDS b1491 EG13794 orf; hypothetical protein 1566978-1568513 - CDS xasA EG12456 acid sensitivity protein; putative transporter

Reported regulatory sites for b1491: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.232 1566930-1566952 R gacaa GGGAGCGATAATTCATCGCTCCC ttttt - 0 - 2.232 1566961-1566980 R aacac TAACCATGTCTGAATGGTTA taaga - 0 - - 0.198 1566853-1566870 R cacat CTGTTTACCGGAAACCAG cacat - 0 - -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back