b1498

Information for b1498, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1577657-1578829 - CDS b1497 EG13795 putative enzyme 1578866-1580581 - CDS b1498 EG13796 putative sulfatase 1580950-1581711 - CDS b1499 EG13797 putative ARAC-type regulatory protein

Reported regulatory sites for b1498: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.261 1580826-1580845 R ataaa TAAGTGACATCCATCACATA tttat - 0 - 3.261 1580612-1580631 R ctctt TATGTGACTAACTTCACTTA catcc - 0 - 3.054 1580756-1580777 R aattc TGCATTTTGTCAGTAAAATGCA ataat - 0 - - 2.125 1580846-1580863 R ggcga TATATTTATTGAAATAAA taagt - 0 - 2.125 1580729-1580746 R tttat TAAATATCAATAAATTAG ttgtt - 0 -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back