b1501

Information for b1501, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1581786-1581983 - CDS b1500 - orf; hypothetical protein 1582231-1584510 - CDS b1501 EG13798 putative oxidoreductase; major subunit 1584844-1585758 - CDS b1502 EG13799 putative adhesin; similar to FimH protein

Reported regulatory sites for b1501: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.070 1584764-1584782 R ttttg TGAAGGCTATTAGCCTACA cctgt - 0 - - 0.250 1584604-1584619 R aaaga GAGTAGTCCCCTACTC ttata - 0 - - 0.000 1584634-1584657 R attta ATCTATTGTTTAACGATAATAGAT taaaa - 0 - -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back