b1520

Information for b1520, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1605370-1606128 + CDS b1519 EG13812 putative enzyme 1606132-1607097 - CDS b1520 EG13813 orf; hypothetical protein 1607253-1608704 - CDS uxaB EG11065 altronate oxidoreductase

Reported regulatory sites for b1520: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.781 1607128-1607143 R cctgc TAATGTTGTAAGCTTG taggt - 0 - 0.647 1607215-1607236 R cttct GAACCCGGTTTCGACCGGGTTT cttat - 0 - 0.059 1607173-1607194 R tagtt ACAACATCCTATATGCCTTTAT catta - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back