b1541

Information for b1541, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1626376-1627062 + CDS ydfH EG13820 orf; hypothetical protein 1627239-1627442 + CDS b1541 EG13838 orf; hypothetical protein 1627477-1628937 - CDS ydfI EG13821 putative oxidoreductase

Reported regulatory sites for b1541: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.531 1627139-1627156 agatg TGAGCTTGATCAAAAACA aaaaa - 0 - 1.870 1627073-1627092 ttcct CTCATCCCATCCGGGGTGAG agtct - 0 - - 0.850 1627205-1627227 cgtgg GCTTCGACTGTAAATCAGAAAGG agaaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back