b1543

Information for b1543, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1627477-1628937 - CDS ydfI EG13821 putative oxidoreductase 1629026-1630309 - CDS b1543 EG13822 putative transport protein 1631063-1631329 + CDS ydfK EG13823 orf; hypothetical protein

Reported regulatory sites for b1543: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.682 1630644-1630662 R tcaag GTGATATAGCCTATATGCC tttga - 0 - 0.460 1630484-1630506 R agccg TTCTTGATTTTACGCATAAATCC atgaa - 0 - 0.460 1630423-1630445 R ttggg GCATATATGGGACAGAAATAGGC cccag - 0 - 0.275 1630374-1630392 R tagga TGCTTTTTAAAAAAATGCA actat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back