b1598

Information for b1598, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1669373-1669708 + CDS asr EG12149 acid shock protein 1669984-1670805 + CDS b1598 EG13925 orf; hypothetical protein 1670844-1671173 - CDS b1599 EG13926 possible chaperone

Reported regulatory sites for b1598: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.295 1669952-1669968 tgctt TTAATAATCATAATTAC ccacc - 0 - 3.032 1669883-1669906 ttcct GATTGTAGTTATCTGATTTTACTC ccact - 0 - 2.918 1669758-1669778 acggt GCTAAGCGGGTAACGTTTAGC accgc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back