b1600

Information for b1600, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1670844-1671173 - CDS b1599 EG13926 possible chaperone 1671160-1671525 - CDS b1600 EG13927 possible chaperone 1671937-1672971 + CDS b1601 EG13928 putative transport protein

Reported regulatory sites for b1600: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.480 1671774-1671789 R ctacc GAGGACAATTATCATC cgcga - 0 - 4.480 1671736-1671751 R acact GCGGATAATTGTAATA ttatg - 0 - 3.443 1671651-1671672 R cacta TCTTGCTCGTAGGTGAGCAGCA ctggc - 0 - 3.443 1671528-1671549 R taaaa TAATTCTCTTGCAGGAGAAGGA caatg - 0 - 2.384 1671830-1671851 R gtaaa GAAGTGAAAATATTTTGAGTTA attct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back