b1601

Information for b1601, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1671160-1671525 - CDS b1600 EG13927 possible chaperone 1671937-1672971 + CDS b1601 EG13928 putative transport protein 1672996-1674384 - CDS pntB EG10745 pyridine nucleotide transhydrogenase; beta subunit

Reported regulatory sites for b1601: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.483 1671831-1671850 gaatt AACTCAAAATATTTTCACTT cttta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.925 1671770-1671790 gtcat CGCGGATGATAATTGTCCTCG gtagt - 0 - 4.596 1671732-1671747 tgtcc ATAATATTACAATTAT ccgca - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back