b1605

Information for b1605, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1676451-1677395 + CDS b1604 EG13929 orf; hypothetical protein 1677581-1678963 + CDS b1605 EG13930 putative arginine/ornithine antiporter 1679000-1679722 + CDS ydgB EG13189 putative oxidoreductase

Reported regulatory sites for b1605: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.654 1677439-1677456 ttcgc ATTTTTAGTCACAAATTT ccccg - 0 - 1.654 1677561-1677578 atcac GTTTTAATCACTGGATAT cgatg - 0 - 1.249 1677526-1677549 ttttt ATGCGTTTTGCCCTAATATTTATT cttct - 0 - 1.043 1677483-1677505 acaca TCTCTTCGTAAAATCCCGCGCTT cagtg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back