b1624

Information for b1624, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1700257-1701258 + CDS add EG10030 adenosine deaminase 1701292-1702371 - CDS b1624 EG13931 orf; hypothetical protein 1702973-1703188 + CDS b1625 EG14303 orf; hypothetical protein

Reported regulatory sites for b1624: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.105 1702585-1702608 R aagaa CGATCCAACCTGTTAATTCAATAA gacga - 0 - 1.105 1702525-1702548 R ttgat CCATTAACTTCAGGGGGTAAATGT tactt - 0 - 0.872 1702813-1702828 R aaaag AGTAACGCGCTTTACT atccc - 0 - 0.630 1702792-1702811 R tacta TCCCTGACAATCACCAACAA catcg - 0 - 0.630 1702648-1702667 R tcagg TGGCTGATAGTTGTCAATGT gactc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back