b1627

Information for b1627, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1703250-1703714 + CDS b1626 EG13932 orf; hypothetical protein 1703791-1704372 + CDS b1627 EG13933 orf; hypothetical protein 1704372-1704950 + CDS b1628 EG13934 orf; hypothetical protein

Reported regulatory sites for b1627: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.815 1703756-1703777 ttaac GGATAATAGGCGGCTTTTTTAT ttcag - 0 - 3.545 1703714-1703737 ccgta ATAACCTTACAGTTAACCTGTTGT cgcct - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back