b1643

Information for b1643, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1718414-1718854 - CDS slyA EG13408 transcriptional regulator for cryptic hemolysin 1719049-1719285 + CDS b1643 EG13943 orf; hypothetical protein 1719246-1720145 + CDS b1644 EG13944 putative membrane protein

Reported regulatory sites for b1643: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.090 1718923-1718946 gctaa AACAAATGTATTGCTGCATTTGGT taccg - 0 - 4.456 1718863-1718883 cttat AATTAGCTTGCTAAGATATTA tgcgg - 0 - 1.895 1718896-1718917 tttag AATAGTGTGCAGCAATTGTATT gctaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back