b1688

Information for b1688, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1763653-1766709 - CDS ydiJ EG13969 putative oxidase 1767098-1768210 + CDS b1688 EG13970 orf; hypothetical protein 1768612-1768995 + CDS b1689 EG13971 orf; hypothetical protein

Reported regulatory sites for b1688: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.747 1766982-1767004 cagaa TTAAGGGCAGAATCGGCCTGTTA aaaac - 0 - 3.747 1767005-1767027 tgtta AAAACCGCTGAAATTGCTCATCA ttatg - 0 - 1.643 1767055-1767078 ttcac GTCGCGTCGACGATTTGACGCACA aaaaa - 0 - 0.598 1766764-1766782 ttcag GCTGCTGCAATAGCGCACT gaaag - 0 - 0.598 1766817-1766835 ttcgt GTTGCAGGAAGGCGGCAAG cgagt - 0 IRU10 (19)

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back