b1706

Information for b1706, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1787637-1787828 + CDS ydiE EG12391 orf; hypothetical protein 1787832-1789268 - CDS b1706 EG13980 orf; hypothetical protein 1789331-1790044 - CDS b1707 EG13981 orf; hypothetical protein

Reported regulatory sites for b1706: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.693 1789311-1789333 R agcga TAACCCTTCTGTTTGCTGGTGTT taaga - 0 - 1.380 1789287-1789302 R gacga GAGTAACCGTCTACAC tatca - 0 - 1.368 1789294-1789317 R tttgc TGGTGTTTAAGACGAGAGTAACCG tctac - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back