b1724

Information for b1724, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1804394-1805323 + CDS pfkB EG10700 6-phosphofructokinase II; suppressor of pfkA 1805424-1805714 + CDS b1724 EG13985 orf; hypothetical protein 1805820-1806680 + CDS b1725 EG13986 orf; hypothetical protein

Reported regulatory sites for b1724: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.227 1805331-1805352 aaaac ATTCCCCCAGCATTGGGGGAAT catca - 0 - 1.184 1805365-1805386 aacct GTCGGCAACGCGTTTCTCCGAC tatgc - 0 - 0.168 1805389-1805411 gacta TGCTCAAAAGTCATGTGATAACA aaggg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back