b1725

Information for b1725, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1805424-1805714 + CDS b1724 EG13985 orf; hypothetical protein 1805820-1806680 + CDS b1725 EG13986 orf; hypothetical protein 1806721-1807257 - CDS b1726 EG13987 orf; hypothetical protein

Reported regulatory sites for b1725: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.446 1805789-1805805 acctt ATGATCTGGCAGACAAC atggg - 0 - 3.219 1805772-1805793 accgc ATTCTTGCGCTAACCTTATGAT ctggc - 0 - 3.038 1805714-1805737 aaata AATGGTTTTTGGGCAATAATCAGT ctgtg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back