b1726

Information for b1726, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1805820-1806680 + CDS b1725 EG13986 orf; hypothetical protein 1806721-1807257 - CDS b1726 EG13987 orf; hypothetical protein 1807404-1808072 + CDS yniC EG13988 putative phosphatase

Reported regulatory sites for b1726: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.972 1807271-1807286 R aagtg AAACGACGCGTCTTAA tcaag - 0 - 2.978 1807315-1807335 R tcata TCGCCTTTAAAGAATGGGCGA aaaca - 0 - 2.949 1807382-1807400 R attac AACCTCTCCTTTAGAGCAT tatgt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back