b1729

Information for b1729, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1808223-1808825 + CDS b1728 EG13989 orf; hypothetical protein 1808958-1810349 + CDS b1729 EG13990 part of a kinase 1810353-1811168 - CDS b1730 EG13991 orf; hypothetical protein

Reported regulatory sites for b1729: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.737 1808849-1808872 tctgg AATAAGCAATTCCATTTGAATATA agagc - 0 - 1.175 1808878-1808900 agagc CAGCTCACAGTTCTGTTAATCTT gcgcc - 0 - 0.738 1808927-1808943 cgcag TGATAGAAATAATAAGA tcagg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back