b1809

Information for b1809, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1889349-1891259 - CDS b1808 EG13513 putative enzyme 1891343-1891735 + CDS b1809 EG13514 orf; hypothetical protein 1892097-1892456 + CDS b1810 EG13515 orf; hypothetical protein

Reported regulatory sites for b1809: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.778 1891265-1891286 actac CCCCTGTTGATTTGAACAGGGA ttatg - 0 - 3.171 1891296-1891313 gtcag GATGAGGGCGCTTTCGCC agttg - 0 - 3.171 1891323-1891340 gaagt GGTGACGGCGACCTCACA ttgtg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back