b1815

Information for b1815, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1894956-1896320 + CDS sdaA EG10930 L-serine deaminase 1896421-1898049 + CDS b1815 EG13516 orf; hypothetical protein 1898053-1899609 - CDS yoaE EG13517 putative transport protein

Reported regulatory sites for b1815: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.249 1896332-1896354 ttact CGCCCATCTGCAACGGATGGGCG aattt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.434 1896392-1896412 ttccc CACTACACTTCCACTGTTGCG tcagg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back