b1833

Information for b1833, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1913655-1914206 - CDS b1832 EG14020 orf; hypothetical protein 1914282-1915565 + CDS b1833 EG14021 orf; hypothetical protein 1915528-1918167 + CDS b1834 EG14022 orf; hypothetical protein

Reported regulatory sites for b1833: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.585 1914209-1914232 catta AATGCGTTAATGCTCAAGATCATT cccat - 0 - 1.642 1914250-1914266 taaga TTAATGTTAATTCTTAT tacat - 0 - 0.872 1914225-1914245 gctca AGATCATTCCCATCATGGGTT aagat - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back