b1953

Information for b1953, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2022657-2022845 - CDS dsrB EG12636 orf; hypothetical protein 2022993-2023235 + CDS b1953 EG14387 orf; hypothetical protein 2023250-2023334 - misc_RNA dsrA EG31118 Small Regulatory RNA; positive regulation of promoters sensitive to HNS negative regulation

Reported regulatory sites for b1953: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.329 2022864-2022882 tggct TTGTGCCAGTGTAGAACAA tttcg - 0 - 2.692 2022925-2022941 tgatt TTCTCGACGGTCTATAC ttaag - 0 - 0.834 2022900-2022921 ggcag CGCCAGGCGCGCGCGAGTGCTG atttt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back