b1971

Information for b1971, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2036978-2037391 + CDS b1970 EG14046 orf; hypothetical protein 2037500-2038504 + CDS b1971 EG14047 putative reductase 2038505-2039140 + CDS b1972 EG14048 orf; hypothetical protein

Reported regulatory sites for b1971: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.279 2037391-2037406 agtta ATGCATAAATATGTAA aagca - 0 - 1.279 2037407-2037422 tgtaa AAGCAGATCTCTGCTA ctgtt - 0 - 0.329 2037443-2037459 ctccc TGACAGATTAACAGTAA acggc - 0 - 0.329 2037467-2037483 ggctc TTGCTGGCTAACGACAA aaaag - 0 - 0.009 2037424-2037447 gctac TGTTAGGGAGGACACTCCCTGACA gatta - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back