b1983

Information for b1983, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2053083-2054537 + CDS amn EG10039 AMP nucleosidase 2054880-2055596 + CDS b1983 EG13382 orf; hypothetical protein 2056049-2056124 - tRNA asnW EG31120 Asparagine tRNA

Reported regulatory sites for b1983: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.490 2054844-2054860 tttac CAGTAATGTAAATAAAT tttcg - 0 - 2.202 2054802-2054822 tcctg TTATGATATAATATGCTGAAT taaca - 0 - 1.666 2054535-2054556 tccga TAATAAGTTCTGAACCTTCTTA tcaga - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back