b2249

Information for b2249, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2359449-2360231 - CDS b2248 EG14086 putative regulator 2360451-2361653 - CDS b2249 EG14087 orf; hypothetical protein 2361753-2362316 - CDS b2250 EG14088 orf; hypothetical protein

Reported regulatory sites for b2249: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.683 2361668-2361689 R tttgc GTTATAGTGATTCGATAACAAA agcag - 0 - 1.036 2361734-2361749 R gatcc CTTCCGGCGCGGCATT ctgtc - 0 - 1.036 2361699-2361714 R agttt CTTACTACGCCTTATC tccct - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back