b2250

Information for b2250, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2360451-2361653 - CDS b2249 EG14087 orf; hypothetical protein 2361753-2362316 - CDS b2250 EG14088 orf; hypothetical protein 2362574-2362999 + CDS yfaO EG13275 orf; hypothetical protein

Reported regulatory sites for b2250: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.830 2362434-2362457 R tgtgt ATCGATAAAGTGTGTTTATTTTTT cggca - 0 - 1.830 2362373-2362396 R caata AGTGACTAGATCCTTTTTTTCGCT cattg - 0 - 1.360 2362552-2362567 R gggat ATTCCTTATAAATAAA aagaa - 0 - 1.360 2362409-2362424 R attta ATTATTTAAGAAGTAT ttagt - 0 - 1.079 2362329-2362348 R ggcag TACAATCCCGCAGCTTTGGG aattt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back