b2253

Information for b2253, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2363038-2363640 - CDS ais EG13155 protein induced by aluminum 2363915-2365087 + CDS b2253 EG14089 putative enzyme 2365091-2366059 + CDS b2254 EG14090 putative sugar transferase

Reported regulatory sites for b2253: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.608 2363820-2363843 tacgt CTAATATTAGTTTCTTAAGGTTAA gttaa - 0 - 3.608 2363845-2363868 ttaag TTAATATTCTATCCTTAAAATTTC gctcc - 0 - 0.959 2363682-2363701 taccg TGAAATTGAGCTACATTTCT ggcga - 0 - 0.959 2363749-2363768 gtcgg CAAAATGCCTCAAAATTTTG ccaaa - 0 - 0.943 2363717-2363739 cgcag TTGGTGTAATATTAAAAATCCTA cgatg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back