b2258

Information for b2258, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2368928-2370580 + CDS b2257 EG14093 orf; hypothetical protein 2370630-2371298 + CDS b2258 EG14094 putative transport/receptor protein 2371292-2371588 - CDS pmrD EG12671 polymyxin resistance protein B

Reported regulatory sites for b2258: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.281 2370582-2370605 atgat CTGGCTAACATTAGTCTTTGCCAG cttgc - 0 - - 2.668 2370608-2370629 cagct TGCTTAGCGTTGCCGGGCAGTT gtgtc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back