b2291

Information for b2291, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2405581-2406798 + CDS b2290 EG14101 putative aminotransferase 2406882-2407481 + CDS b2291 EG14102 putative alpha helix protein 2407540-2409372 - CDS yfbS EG14103 putative transport protein

Reported regulatory sites for b2291: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.213 2406855-2406876 gacct GATGATGTCATCATACGTAAGG tcact - 0 - 1.125 2406796-2406814 agctg TAATCTTAATTTCACTGCC ggaga - 0 REPt167 (3) 0.373 2406819-2406836 cggag ATTGCATCCGGCAGCGTT atccc - 0 REPt167 (12)

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back