b2294

Information for b2294, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2409459-2410127 - CDS yfbT EG14104 putative phosphatase 2410120-2410632 - CDS b2294 EG14105 orf; hypothetical protein 2410697-2411152 - CDS b2295 EG14106 orf; hypothetical protein

Reported regulatory sites for b2294: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.738 2410650-2410673 R tataa AAGAAGGCATACTCAGCCTTCTTT ttttt - 0 - 3.068 2410674-2410696 R tgtaa TTGACCCCTGATTACGCATATAA aagaa - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back