b2295

Information for b2295, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2410120-2410632 - CDS b2294 EG14105 orf; hypothetical protein 2410697-2411152 - CDS b2295 EG14106 orf; hypothetical protein 2411490-2412692 + CDS ackA EG10027 acetate kinase

Reported regulatory sites for b2295: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.248 2411399-2411419 R gacac CGACATTTATGATTAACATCA tgcac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.091 2411456-2411479 R tacct ATAATTGATACGTGGCTAAAAAAA cgtca - 0 - 4.091 2411365-2411388 R tgcaa ATTTTTTTTGCATGATGGAAGAAA tatct - 0 - 3.828 2411173-2411192 R tttgc ACAAATTTTTGAATCTTTAT atgtg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back