b2322

Information for b2322, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2435970-2436965 + CDS div EG10229 cell division protein 2436962-2438140 - CDS b2322 EG14113 putative transport protein 2438405-2439625 - CDS fabB EG10274 3-oxoacyl-[acyl-carrier-protein] synthase I

Reported regulatory sites for b2322: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.291 2438141-2438157 R gcgct GCATTCTGGAGTAATGC atgac - 0 - 1.870 2438225-2438240 R tctga AAAGACGTACGCGTTA aatcc - 0 - 1.809 2438332-2438355 R tacgc GCCAATGCGGCCTCCGGCACTAAC gcaaa - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back