b2343

Information for b2343, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2457179-2458489 - CDS b2342 EG14128 putative acyltransferase 2458670-2458978 - CDS b2343 EG14129 orf; hypothetical protein 2459320-2460666 + CDS fadL EG10280 transport of long-chain fatty acids; sensitivity to phage T2

Reported regulatory sites for b2343: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.511 2459273-2459289 R aacta TGTTACGTGCTGTAACA ggagc ompR 17 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.562 2459151-2459173 R tatct TTTTTCAAATATGATCTAAGAAA cgcga ompR 23 - 5.378 2459057-2459080 R cattt TTAAGTGTGATTTCGGTCACTTAT ccgat ompR 20 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back