b2373

Information for b2373, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2487262-2488206 - CDS b2372 EG14144 putative receptor protein 2488276-2489970 - CDS b2373 EG14143 putative enzyme 2490024-2491274 - CDS b2374 EG14145 putative enzyme

Reported regulatory sites for b2373: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.486 2489973-2489994 R aattt ATAAAAATTTCGAGGTTATTAA tcatg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back