b2377

Information for b2377, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2492718-2492993 + CDS b2376 EG14376 orf; hypothetical protein 2493070-2493312 - CDS b2377 EG14147 orf; hypothetical protein 2493599-2494585 + CDS ddg EG12901 putative heat shock protein

Reported regulatory sites for b2377: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.767 2493563-2493581 R tcatg TACGACAATGGTTCCTGTA aagag - 0 - 1.539 2493449-2493472 R actga TTATTAATCGTGCAAAGTAAATAT ttttc - 0 - 1.258 2493534-2493556 R agagt GTAAAGACTAGTCAGGACATAAC cacga - 0 - 1.258 2493358-2493380 R cagag GTTAAGGATTGTCTTACTATTAA agtga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back