b2379

Information for b2379, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2493599-2494585 + CDS ddg EG12901 putative heat shock protein 2495077-2496315 - CDS b2379 EG14198 putative aminotransferase 2496691-2498388 + CDS b2380 EG14148 putative sensor protein

Reported regulatory sites for b2379: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.293 2496339-2496355 R gcgtc GCTCGGACGGTCCGGGC gctaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.790 2496382-2496402 R agaca GAAATTAATCAGGCTATTTTC aaaac - 0 - 2.584 2496457-2496478 R gcgca GATAAATTTCCTGTTTTTAAAG cagag - 0 - 2.584 2496415-2496436 R aacgt CATTAATAAAATGTTCTAAAAC gctgg - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back