b2380

Information for b2380, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2495077-2496315 - CDS b2379 EG14198 putative aminotransferase 2496691-2498388 + CDS b2380 EG14148 putative sensor protein 2498403-2499137 + CDS b2381 EG14149 putative 2-component transcriptional regulator

Reported regulatory sites for b2380: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.977 2496379-2496398 gctgt TTTGAAAATAGCCTGATTAA tttct - 0 - 1.977 2496584-2496603 attta TCTATCAATCCCCTTTTAAA attgt - 0 - 0.932 2496451-2496469 gagga ACTCTGCTTTAAAAACAGG aaatt - 0 - 0.932 2496501-2496519 tacca CTCATTTTATTAACATAAT aattt - 0 - 0.537 2496608-2496627 aattg TGGTTTTTCCTCAAAAACGG cctgc - 0 -

Critical MAP values: p=0.01 4.11 p=0.05 2.92 p=0.1 2.48 p=0.2 2.01

Click here to go back