b2392

Information for b2392, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2509085-2509429 + CDS b2391 - orf; hypothetical protein 2509488-2510726 - CDS b2392 EG14157 putative transport system permease 2511062-2512264 + CDS nupC EG11971 permease of transport system for 3 nucleosides

Reported regulatory sites for b2392: Genome coordinates Source Transcription factor Transcription factor annotation 2510734-2510763 PMID: 11466284 mntR repressor of mntH

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.707 2510739-2510760 R gcatg AAACATAGCAAAGGCTATGTTT tagag mntR 22 - 6.382 2510774-2510790 R tgaat TTGATAATCATTCTCGT ttggc - 0 - 5.865 2511041-2511058 R atatt TGCTCCAAATATGAGGCA ggtta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back