b2431

Information for b2431, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2546035-2547426 + CDS b2430 EG14164 putative beta-lactamase 2547666-2548592 - CDS b2431 EG14165 orf; hypothetical protein 2548661-2549236 - CDS b2432 EG14166 orf; hypothetical protein

Reported regulatory sites for b2431: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.716 2548641-2548657 R aattt GCGTCTGAACAAACCGC cgccg - 0 - 2.298 2548603-2548624 R aacac GTAAAATAGCGCTCAACAATGC cacgg - 0 - 0.556 2548595-2548611 R gcgct CAACAATGCCACGGATT gcgtg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back