b2434

Information for b2434, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2549297-2549752 - CDS b2433 EG14167 orf; hypothetical protein 2549733-2550269 - CDS b2434 EG14168 orf; hypothetical protein 2550372-2551241 + CDS amiA EG11823 N-acetylmuramoyl-l-alanine amidase I

Reported regulatory sites for b2434: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.589 2550312-2550332 R tatat CGTATCGCGTAATCCGTTACG acggt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.827 2550278-2550300 R tgctg TTGAGAATTGTTTTACTTTTCAT ttcaa - 0 - 4.102 2550333-2550354 R gtaat AATAAAGTTCCAGATGTTATAT cgtat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back