b2462
 
Information for b2462, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2572998-2573477
-
CDS
orf; hypothetical protein
2573490-2573897
-
CDS
b2462
orf; hypothetical protein
2574118-2576397
-
CDS
putative multimodular enzyme
 
Reported regulatory sites for b2462:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.308
2574076-2574099
aactg CTTACCCTGAATATTCAGGGTAAG cgtga
-
0
-
2.308
2574049-2574072 R
agcag TTTAGCTGCAATATATTAGTAAAG cttat
-
0
-
2.302
2573910-2573925 R
ttctt AGTGATCTACCTCACC tttta
-
0
-
0.744
2573988-2574009 R
agtct ATATAATATCTCGATATTATTT tattt
-
0
-
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back