b2475

Information for b2475, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2591864-2593879 - CDS ypfI EG14196 orf; hypothetical protein 2593894-2594757 - CDS b2475 EG14197 orf; hypothetical protein 2594925-2595638 - CDS purC EG10791 phosphoribosylaminoimidazole-succinocarboxamide synthetase = SAICAR synthetase

Reported regulatory sites for b2475: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.527 2594811-2594829 R catcc CGCTTTCCTGTGGTAATCT tcctc - 0 - 1.302 2594874-2594893 R agctg GCACGGCAAGACAACCGCTC tcgga - 0 - 1.101 2594774-2594797 R accac CTACGATCATTTCTATAATGAATA tattg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back