b2494

Information for b2494, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2612840-2613901 - CDS perM EG14221 putative permease 2614114-2615577 + CDS b2494 EG14199 orf; hypothetical protein 2615598-2615957 + CDS b2495 EG14200 putative oxidoreductase

Reported regulatory sites for b2494: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.966 2613945-2613966 cgcaa TTGTATCGAAATGTCACAAAAA agact - 0 - 1.531 2613916-2613939 ccctg AACCTCAAGAGCGGGATTGCGATC cgcaa - 0 - 1.531 2614056-2614079 ggtgg GAACGATATTTCACAGTATCGGTC aaatg - 0 - 1.002 2613981-2613997 ttttt ATGACGGATTCAGGAAA ctgaa - 0 - 1.002 2614025-2614041 taatc TTCGCCGTTACACTCAA aggcg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back