b2496

Information for b2496, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2615598-2615957 + CDS b2495 EG14200 putative oxidoreductase 2616095-2616841 - CDS b2496 EG14201 putative DNA replication factor 2616891-2618180 - CDS uraA EG12129 uracil transport

Reported regulatory sites for b2496: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.672 2616862-2616882 R accga CCGGGCAGTGTTGCTGCCCGG ttcaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.747 2616846-2616867 R ttgct GCCCGGTTCAAACATCATGGGA ttctg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back