b2511

Information for b2511, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2633619-2633870 - CDS b2510 EG14206 orf; hypothetical protein 2633904-2635415 - CDS b2511 EG14207 putative GTP-binding factor 2635494-2636672 - CDS b2512 EG14208 putative dehydrogenase

Reported regulatory sites for b2511: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.168 2635444-2635459 R tcctg GACAGGGGCCGTTTTC ctgtt - 0 - 1.241 2635457-2635477 R gttca CTTTGAAAACGGCTCCTGGAC agggg - 0 - 1.142 2635428-2635443 R ttttc CTGTTTTTAACAACGA cgcga - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back