b2595

Information for b2595, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2733051-2734031 - CDS sfhB EG12098 suppressor of ftsH mutation 2734166-2734903 + CDS b2595 EG14222 orf; hypothetical protein 2734933-2735139 + CDS b2596 - orf; hypothetical protein

Reported regulatory sites for b2595: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.254 2734141-2734164 gtatt ACATTTTGAGGAAAGTCAAAACGT catga - 0 - 4.345 2734077-2734100 tgccg TTTAATATAGTGTGCTATTGTAGC tggtc - 0 - 3.762 2734034-2734050 catat ATACTGCTTCTTCGTTT atcgt - 0 - 3.762 2734063-2734079 gggtt TTACGGCTTTGCCGTTT aatat - 0 - 3.562 2734121-2734137 gcagg AACAGAGAATCTCCCGT attac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back