b2619

Information for b2619, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2752029-2752337 - CDS b2618 EG13192 orf; hypothetical protein 2752309-2752785 - CDS b2619 EG13193 orf; hypothetical protein 2752917-2753399 + CDS smpB EG11782 small protein B

Reported regulatory sites for b2619: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.135 2752881-2752904 R gtgaa TCATCGGTAATCTGAAATCGAAAA caccc - 0 - 0.707 2752836-2752854 R gggac AAGGCTCTATCTTAGCATG aaccc - 0 - 0.687 2752796-2752813 R cgccg GGATAGCGTTTTTTTTAC agcag - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back